Effects of fiber type, particle size, and inclusion level on the growth performance, digestive organ

ساخت وبلاگ


Effects of fiber type, particle size, and inclusion level on the growth performance, digestive organ growth, intestinal morphology, intestinal viscosity, and gene expression of broilers
O.J. Tejeda and W.K. Kim1

Author information Article notes Copyright and License information PMC Disclaimer

Go to:

Abstract
The aim of this study was to evaluate the effect fiber type, particle size, and inclusion level on the performance parameters, intestinal development and gene expression in broiler chickens. A total of 648 one-day old Cobb male broilers were randomly assigned to a control diet and 8 other dietary treatments divided in 2 fiber types (cellulose vs. soyhulls), 2 particle sizes (100 and 600 µm), and 2 inclusion levels (4 and 8% crude fiber). Birds were reared to 21 days of age in battery cages (n = 6 replicates). Growth performance parameters and intestinal viscosity were measured on da 7, 14, and 21. On d 14 and 21, digestive organ weights were recorded for analyses of organ growth. On d 21, intestinal samples were taken for analyses of histology, and jejunal mucosas were collected for analyses of nutrient transporters. Data were analyzed as a 2 × 2 × 2 factorial design using JMP 2021. Treatments were compared against the control group using one-way analysis of variance, whereas the main effect interactions were evaluated as a factorial excluding the control group to be able to assess the effect of the independent variables without the variability introduced by the control group. The groups fed 8% crude fiber from cellulose (8% CL) had the lowest weight gain regardless of the particle size (P SH) with a coarse particle size had the heaviest relative gizzard weight among the treatments (P = 0.045). The groups fed 8% SH had the heaviest small intestine weights regardless of the particle size (P = 0.009). No differences were observed in the relative weights of the ceca. The highest viscosity was observed in the group fed 8% SH with a fine particle size (P
Key words: fiber, particle size, inclusion level, intestinal morphology, broiler

Go to:

INTRODUCTION
Current tendencies to incorporate cheaper feed ingredients in the formulation of poultry diets have led to the adoption of fibrous feed ingredients. Different feedstuffs vary in the type, amount, and proportions of dietary fiber (DF) that they contain (Knudsen, 2014; Jaworski et al., 2015; Nguyen et al., 2019), which provides a wide array of potential physiological and nutritional implications when used in broiler diets (Hetland et al., 2003; Owusu-Asiedu et al., 2006; Jiménez-Moreno et al., 2016). Dietary fiber has been associated with changes in growth performance (Hetland and Svihus, 2001; Jiménez-Moreno et al., 2016), intestinal morphology (Sklan et al., 2003; Sittiya et al., 2020), and nutrient digestibility (Cao et al., 2003; Tejeda and Kim, 2020) that are generally ignored when using fibrous by-products as feed ingredients.

Fiber type, amount used, and particle size are the most crucial factors to bear in mind when using dietary fiber as a functional nutrient in the nutrient matrix (O'Dell et al., 1959; Hetland et al., 2004; Tejeda and Kim, 2021). Fiber type can be explained in terms of the ability of the fibrous components to form interactions with water molecules (i.e., soluble or insoluble) (Chaplin, 2003). Viscous soluble fibers have been associated with impairment in growth performance due to disruption of normal enzymatic activity and nutrient digestibility (Hetland et al., 2004; Saki et al., 2011). Insoluble fibers used in low amounts (i.e., 3–5%) have been shown to modulate intestinal morphology and nutrient utilization (Chiou et al., 1996; Tejeda and Kim, 2020). Particle size seems to have a paramount role in modulation of intestinal motility and subsequently nutrient utilization (Kheravii et al., 2018a). This beneficial effect has been reported to be important along the different portions of the gastrointestinal tract for both, big and small particle sizes (Amerah et al., 2007).

It has been clearly demonstrated that the dietary fiber modulates intestinal development (Sklan et al., 2003; Sadeghi et al., 2015) and general nutrient metabolism (Hetland et al., 2004; Georgieva et al., 2014; Kheravii et al., 2018a) depending on the type and amount incorporated in the diet. However, little is known about the role that particle size plays when using different fiber types and inclusion level. Therefore, the objective of this study was to evaluate the effects of 2 sources of fiber (cellulose [CL] and soybean hulls [SH]), 2 inclusion levels (4 and 8% crude fiber [CF]), and 2 particles sizes (100 and 600 µm) on the growth performance, digestive organ growth, intestinal viscosity, intestinal morphology, nutrient digestibility, and gene expression of broilers.

Go to:

MATERIAL AND METHODS
General Procedures
The experiment was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Georgia (Athens, GA). A total of 648, one-day-old male Cobb500 broiler chicks were allocated in a completely randomized factorial designed with 9 dietary treatments and 6 replicates of 12 birds each. There were 3 main factors namely, fiber type (CL and SH), inclusion levels (4 and 8% CF), and particle size (100 and 600 µm). The chicks were allocated in 54 cages equipped with one drinker and one feeder, providing ad-libitum access to water and mash feed from 1 to 21 days of age. Temperature and lighting programs followed the recommendation of Cobb Broiler Management Guide (Cobb-vantress, 2018).

Dietary Treatments
All diets were corn and soybean meal-based formulated to meet the nutrient requirements specified by Cobb500 performance and nutritional guide (Cobb-Vantress, 2018). The control diet was formulated to contain 2% CF. The control diet was used as a basal diet to which purified cellulose (CL: 99% cellulose, Solka floc, Skidmore, Schollcraft, MI) was added as a source of CF by replacing an inert filler (sand) to achieve 4 and 8% CF (4% CL and 8% CL) in the diets. Solka floc 100-fcc and solka floc 900-fcc with an average particle size of 100 and 600 µm, respectively, were added separately to their corresponding dietary treatment as sources of purified CL. The rest of experimental diets were added increasing amounts of SH to achieve 4 and 8% CF (4% SH and 8% SH). Particle sizes averaging 100 and 600 µm of SH were obtained using a machine mill with different screen sizes (Fitzpatrick model M comminuting machine mill, the W. J. Fitzpatrick company, Chicago, IL). Proximate analyses of SH were conducted to measure the gross nutrient contents (Table 1). For amino acids and apparent metabolizable energy corrected for nitrogen (AMEn), the nutrient matrix composition used for SH was obtained using cecectomized roosters at the poultry research center at the University of Georgia (Table 2). Diets were provided as mash during the entire rearing period (0–21 d). All diets were isonitrogenous and isocaloric and are shown in Table 3. For ileal nutrient digestibility determination, chromic oxide (Cr2O3, Sigma Aldrich, St. Louis, MO) was added at 0.3% as an indigestible marker to all diets.

Table 1
Proximate analyses of the nutrient composition of soybean hulls.

Item*Value

GE (Kcal/Kg)3,698

AMEn (Kcal/kg)658

Dry matter (%)87.95

Crude protein (%)16.3

Crude fiber (%)35.8

Calcium (%)0.88

Phosphorus (%)0.55

nPP (%)0.37

Open in a separate window

⁎Abbreviations: AMEn, apparent metabolizable energy corrected for nitrogen; GE, gross energy; nPP, non-phytate phosphorus.

Table 2
Analyzed values for amino acid content, digestibility (%) and digestible amino-acid content of soybean hulls based on cecectomized rooster assay.

Amino acidPercent amino acidDigestibility (%)Digestible amino acid content (%)

Alanine0.45039.3860.177

Arginine0.48068.3440.328

Aspartic acid0.95054.0400.513

Cysteine0.16041.4610.066

Glutamic acid1.14051.2940.585

Histidine0.26046.5060.121

Isoleucine0.40043.8500.175

Leucine0.66052.3280.345

Lysine0.73052.7380.383

Methionine0.13057.5830.075

Phenylalanine0.39053.6010.209

Proline0.55055.5920.306

Serine0.53049.3350.261

Threonine0.36050.7220.183

Tryptophan0.06056.1000.034

Tyrosine0.36046.7320.168

Valine0.46033.9510.156

Open in a separate window

Table 3
Ingredient composition of diets fed to male Cobb × Cobb broilers from 1 to 20 d of age1.

Ingredient, %CTL4% CL8% CL4% SH8% SH

Corn49.5649.5649.5653.5938.14

Soybean meal35.0935.0935.0932.3730.48

Solka floc—2.036.07——

Soybean hulls———5.6217.77

Soybean oil5.015.015.013.769.24

Defluorinated phosphate1.051.051.050.1680.63

Biofos 16/21P0.550.550.551.290.98

Calcium carbonate0.910.910.911.240.72

L-Thr0.120.120.120.150.20

DL-Met0.320.320.320.330.36

Lysine HCl0.200.200.200.260.31

Vitamin premix20.250.250.250.250.25

Mineral premix30.150.150.150.150.15

Sodium chloride0.230.230.230.330.28

Filler (sand)6.564.740.50.50.50

Calculated nutrient composition

Dry matter (%)9090909090

ME energy (Kcal/kg)3,0003,0003,0003,0003,000

Protein (%)21.021.021.021.021.0

Crude Fiber (%)2.04.08.04.08.0

Calcium (%)0.900.900.900.900.90

Dig. Phosphorus (%)0.450.450.450.450.45

Dig. Met (%)0.630.630.630.630.63

Dig. TSAA (%)0.900.900.900.900.90

Dig. Lys (%)1.221.221.221.221.22

Dig. Thr (%)0.860.860.860.860.86

Open in a separate window

1All diets, except control, were added fiber at a particle size of 100 and 600 µm.

2Vitamin premix provided the following per kilogram of DSM premix: Vit. A, 2,204,586 IU; Vit. D3, 200,000 ICU; Vit. E, 2,000 IU; Vit. B12, 2 mg; Biotin, 20 mg; Menadione, 200 mg; Thiamine, 400 mg; Riboflavin, 800 mg; d-Pantothenic Acid, 2,000 mg; Vit. B6, 400 mg; Niacin, 8,000 mg; Folic Acid, 100 mg; Choline, 34,720 mg.

3Mineral premix includes per kg of premix: Ca, 0.72 g; Mn, 3.04 g; Zn, 2.43 g; Mg, 0.61 g; Fe, 0.59 g; Cu, 22.68 g; I, 22.68 g; Se, 9.07 g.

Growth Performance and Organ Weights
The birds and feed were weighed weekly per cage to determine mortality-corrected body weight gain (BWG), mortality-corrected feed intake (FI), and mortality-corrected feed conversion ratio (FCR) and results are presented per week. Mortality was recorded twice daily. For organ growth analyses, empty gizzard, small intestine, and ceca were obtained from one average bird per cage (n = 6 per treatment) and weighed to determine the relative organ weight on d 14 and 21.

Intestinal Morphology
On d 21, samples from the mid-duodenum, jejunum and ileum (∼ 2 cm long) were collected from one average bird per replicate cage (n = 6 per treatment). Intestinal contents were flushed with phosphate-buffered saline (PBS) and intestinal sections were stored in 10% neutral-buffered formalin and left in solution for a minimum period of 48 h for tissue fixation. During slide preparation, increasing amounts of ethanol were used to dehydrate the tissues, then diaphanized in dimethylbenzene, and fixed in paraffin. Finally, tissue sections with a thickness of 4 µm were set on slides and were stained using Hematoxylin and Eosin (H&E) procedures. Pictures were taken using a light microscope (10× eyepiece and 1.6× magnification; Leica DC500 camera, Leica Mycrosystems Inc., Buffalo Groove, IL). Measurements for villi height and crypt depth were taken using ImageJ software (Image Processing and Analysis in JAVA – ImageJ 1.52r, National Institutes of Health, Bethesda, MD).

Intestinal Viscosity
On 7, 14, and 21 days of age, one bird per cage was randomly selected and euthanized, and intestinal digesta was collected from the Meckel's diverticulum to the ileocolonic junction. Fresh digesta were centrifuged at 12,600 × g for 5 min and the supernatants were collected for viscosity measurements using a cone and plate Brookfield DV-II + Programmable viscometer at 10 rpm using a CPE-40 spindle (Brookfield engineering laboratories, Inc, Middleboro, MA). A water bath control connected to the cone was used to keep the temperature of the samples at 40°C.

Nutrient Digestibility
On d 21, six birds per replicate cage were euthanized, and ileal digesta were collected from two-thirds of the distal ileum (from Meckel's diverticulum to about 1 inch anterior to ileocecal junction). The digesta samples were dried for analyses of dry matter, crude protein, and energy. The chromium oxide concentration was measured according to Dansky and Hill (1952), and gross energy was evaluated using a bomb calorimeter (IKA Calorimeter C1, IKA Works Inc., Wilmington, NC). The crude protein (N × 6.25) was analyzed using a LECO nitrogen analyzer (LECO, St. Joseph, MI). The apparent ileal digestibility (AID) of dry matter, crude protein, and apparent metabolizable energy (AME) was calculated using the following equation:

AID,%=100[1−(CrfeedCrdig)×(NutrientdigNutrientfeed)]

where Crfeed and Crdig is the chromium dioxide in feed and ileal digesta, respectively; and nutrientdig and nutrientfeed are the nutrient in ileal digesta and feed, respectively.

Quantitative Reverse-Transcriptase Polymerase Chain Reaction
On d 21, samples from the jejunal mucosa were collected from one randomly selected bird per cage, snap-frozen in liquid nitrogen, and stored at −80°C previous to analysis. Jejunal mucosa samples were used to analyze the expression of Na±dependent glucose transporter 1 (SGLT-1), and peptide transporter 1 (Pept-1) genes using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Total RNA was extracted from the samples previously stored at −80°C using QIAzol Lysis Reagent (Qiagen, Germatown, MD) according to the manufacturer's instruction. After extraction, RNA quantity and purity were determined using Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA). The cDNA was synthesized from total RNA and subsequently diluted to 10 ng/µL for qRT-PCR analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The forward and reverse primers for the genes are shown in Table 4. The qRT-PCR was performed on an Applied Biosystems StepOnePlus (Thermo Fisher Scientific, Waltham, MA) with iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA) using the following conditions: 95°C for 15 s, 58°C for 20 s, and 72°C for 15 s during 40 cycles for GAPDH; 95°C for 15 s, 60°C for 20 s, and 72°C for 15 s during 40 cycles for Pept-1; and 95°C for 15 s, 58°C for 20 s, and 72°C for 15 s during 40 cycles for SGLT-1. All reactions were done in duplicate. and relative gene expression data were analyzed using the 2−ΔΔCt method (Livak and Schmittgen, 2001). The mean ΔCt of control group was used to calculate the ΔΔCt value.

Table 4
Primer pairs used for RT-qPCR analyses.

Gene1Gene bank identificationPrimer sequence, forward/reverseProduct size (bp)

SGLT-1AJ236903.1GCCGTGGCCAGGGCTTA/
CAATAACCTGATCTGTGCACCAGT71

Pept-1KF366603.1CCCCTGAGGAGGATCACTGTT/
CAAAAGAGCAGCAGCAACGA66

GAPDHNC_052532.1GCTAAGGCTGTGGGGAAAGT/
TCAGCAGCAGCCTTCACTAC161

Open in a separate window

1Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Pept-1, peptide transporter-1; SGLT-1, sodium-dependent glucose transporter 1.

Statistical Analyses
Fiber type, particle size, and inclusion level were the fixed effects in the model. A pen was used as an experimental unit for growth performance and nutrient digestibility; a bird was used as an experimental unit for organ growth, intestinal morphology, intestinal viscosity, and gene expression. Data were analyzed as a completely randomized block design with 8 treatments organized as a 2 × 2 × 2 factorial design. One-way analysis of variance was used to determine the effect of fiber inclusion compared to the control group, whereas the main effect interactions were evaluated excluding the control group to be able to assess the effect of the independent variables without the variability introduced by the control group. The main effects model used for statistical analyses is as follows:

Yij=μ+αi+βj+δt+αβδijt+εijt

where Yij represents the value for each random variable; µ is the overall mean; αi, βj, δt, and αβδijt are the fiber type, inclusion level, particle size, and their interactions, respectively such that Σαi=0; and the random errors εijt are identically and independently normally distributed with a mean 0 and a variance σ. All statistical procedures were performed using JMP Pro, version 15 (SAS Institute Inc., Cary, NC). In case of significant differences, means were separated using the Tukey's test HSD option. For all hypothesis tests, statistical significance was considered at P
Go to:

RESULTS
Growth Performance
The results for growth performance are presented per week in Table 5. The upper portion of the table includes the control group, and the second portion of the table includes the main effects and their interactions only, without the control group. On d 21, the control group had the heaviest weigh gain during the rearing period but did not differ from the treatments containing 4% CF regardless of the fiber source (P > 0.05). However, the treatments fed 8% CL had the lowest weight gain at the end of the experiment (P 0.05). The results from the main effects show that fiber type did not affect significantly any of the growth performance parameters (P > 0.05). The statistics for the main effects indicate that fine particle size (100 µm) increased the weight gain on d 7 and 14 and improved the FCR on d 7 compared to the coarse particle size (P = 0.021); however, such differences disappeared at the end of the experiment (P > 0.05). Fiber level affected all the growth performance parameters where the highest fiber level (8% CF) resulted in lower weigh gain, lower feed intake, and poorer FCR compare to the groups fed 4% CF (P 0.05). At the end of the experiment, the mortality was higher for groups fed SH, especially treatments given the highest amounts of soyhulls (P
Table 5
Effects of dietary fiber parameters on the growth performance of male broilers reared to 21 d of age1.

BW gain (g/bird)Feed intake (g/bird)Feed conversionMort., %

Fiber type2Particle size (µm)LevelD 7D 14D 21D 7D 14D 21D 7D 14D 21D0-21

Control--124a432a884a144a656a1639a1.17ab1.521.852.78

CL1004%114ab396ab813abc128ab527bc1350ab1.12a1.331.672.78

CL1008%104bc324cd658d122bc480bc1233b1.18ab1.481.874.20

CL6004%107bc377bc818abc131ab558ab1640a1.23b1.502.005.60

CL6008%85d279d641d105c429c1268b1.24b1.541.982.78

SH1004%112abc407ab870ab127ab566ab1497ab1.14a1.391.725.56

SH1008%96cd303d665cd118bc473bc1292b1.23b1.561.944.20

SH6004%115ab368bc767abcd133ab524bc1345ab1.16ab1.421.752.50

SH6008%97cd305d724bcd119bc484bc1427ab1.23b1.601.988.33

Standard error3.5012344.3027.0099.000.030.060.101.35

P-value
Main effects

Fiber typeCL10334473212149813731.191.461.883.84b

SH10534675712451213901.191.491.855.15a

Particle size (µm)100107a358a75212451113431.16a1.441.803.83

600101b332b73712249914201.21b1.511.934.80

Level4%112a387a817a130a544a1458a1.16a1.41a1.78a4.11

8%96b303b672b116b466b1305b1.22b1.54b1.94b4.88

Source of variation (P-value)

Fiber type (T)0.3400.8410.2470.2970.4030.7880.9690.4330.6370.002

Particle size (P)0.0210.0040.4890.5290.4240.2420.0190.0620.0730.980

Inclusion level (L)
Type × Particle size0.0020.4360.69160.0770.8620.1970.0570.3460.209
T × P × L0.3400.0520.0320.1810.0350.0440.6800.4920.410
Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate cages per treatment, each cage with 12 birds.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Intestinal Histomorphology
Results for intestinal morphology are shown in Table 6. Duodenal villus was highest for the treatment fed 4% SH with a coarse particle size, whereas the shortest duodenal villus was observed in the group fed 8% CL with a fine particle size (P
Table 6
Effects of dietary fiber parameters on the intestinal histomorphology of male broilers reared to 21 d of age1.

DuodenumJejunumIleum

Fiber type2Particle size (µm)LevelVillus (µm)Crypt (µm)Ratio (µm)Villus(µm)Crypt (µm)Ratio (µm)Villus (µm)Crypt (µm)Ratio (µm)

Control--3067ab269a11.8ab1817a2208.8ab1340a231ab6.3ab

CL1004%2848bc250ab11.9ab1650abc2148.0abcd1017b206b5.17bc

CL1008%2643c262ab10.5b1597abc2357.1bcd1029b202b5.27bc

CL6004%2841bc236b13.0a1453cd2177.2bcd1045b204b5.3bc

CL6008%2949ab243ab12.6a1644abc2317.3abcd1058b211ab6.69a

SH1004%2962ab256ab12.3ab1758ab2039.0a1004b208ab5.03c

SH1008%3079ab241ab13.3a1237d2156.2d1023b210ab5.04c

SH6004%3163a248ab13.1a1654abc2248.0abcd1138b243a4.96c

SH6008%2900abc247ab12.2ab1493bcd2326.9cd1041b244a4.42c

Standard error64.008.000.5071100.445110.5

P-value
Main effects

Fiber typeCL268223811.791352229b6.25977a2084.97a

SH273123112.291369248a5.98857b1974.63b

Particle size (µm)1002619b227b11.961323b228b6.269071974.87

6002793a242a12.111398a249a5.979272074.73

Level4%2852a240a12.4a1411a247a6.04b868b2044.49b

8%2561b229b11.67b1310b230b6.19a965a2015.11a

Source of variation (P-value)

Fiber type (T)0.0770.1880.1060.4970.0030.132
Particle size (P)
Inclusion level (L)
Type × Particle size0.0300.4170.1990.0780.2380.9220.19580.19310.497

Type × Level0.0430.7120.298
T × P × L0.2060.4410.1220.1460.002
Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate birds per treatment.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Digestive Organ Growth
The results for organ growth are shown in Table 7. The groups fed the diets containing SH had the heaviest gizzard on d 14 but only the group fed SH at 8% CF with coarse particle maintained such increased weight until d 21 (P 0.05). The results of the main effects show that SH-fed groups had a heavier gizzard on d 14 compared to the CL-fed groups (P = 0.006). Fiber type did not significantly affect small intestine or ceca relative weights (P > 0.05). Fiber with coarse particle (i.e., 600 µm) increased the relative weights of the gizzard on d 21 (P = 0.026) compared to fine particle (i.e., 100 µm). The groups fed 8% CF had heavier gizzard and intestines on d 21 (P 0.05).

Table 7
Effects of dietary fiber parameters on the relative weights of male broilers reared to 21 d of age1.

Gizzard, %Small intestine, %Ceca, %

Fiber type2P. size `(µm)LevelD 14D 21D 14D 21D 14D 21

Control--3.6ab2.48ab9.866.31b0.930.74

CL1004%3.15b2.48ab10.637.95ab1.091.02

CL1008%3.30b2.53ab10.967.76ab1.170.9

CL6004%3.73ab2.53ab10.968.94ab1.031.04

CL6008%3.93ab2.93ab9.989.25ab1.411.18

SH1004%3.79ab2.41b9.717.88ab1.140.97

SH1008%4.17a2.63ab11.6510.19a1.090.82

SH6004%3.45ab2.60ab10.577.95ab1.080.88

SH6008%4.09a3.27a11.529.82a1.190.95

Standard error0.170.190.690.700.130.13

P-value
Main effects

Fiber typeCL3.53b2.6210.638.481.171.04

SH3.87a2.7310.868.961.120.90

Particle size (µm)1003.602.51b10.748.441.120.93

6003.802.83a10.768.991.171.01

Level4%3.53b2.5b10.478.18b1.080.96

8%3.87a2.84a11.039.26a1.210.98

Source of variation (P-value)

Fiber type (T)0.0060.4370.6340.3380.5690.144

Particle size (P)0.1020.0260.9690.2760.5540.348

Inclusion level (L)0.0070.0200.2500.0370.1620.883

Type × Particle size0.0020.5000.4760.1710.7190.449

Type × Level0.1630.4360.0730.0470.2850.765

Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate birds per treatment.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Intestinal Viscosity
Results for intestinal viscosity are shown in Table 8. On d 7, the group fed 8% CF as SH with a coarse particle size had the highest intestinal viscosity, and the lowest was for the group fed 8% CF with coarse CL (P = 0.045). On d 14, the groups containing 8% CF as SH had the highest intestinal viscosity regardless of the particle size (P 0.05). Higher fiber inclusion increased the intestinal viscosity on d 14 and 21 (P 0.05).

Table 8
Effects of dietary fiber parameters on the intestinal viscosity of male broilers reared to 21 d of age1.

Viscosity, mPas

Fiber type2Particle size (µm)LevelD 7D 14D 21

Control--6.65ab2.26b2.25c

CL1004%9.07ab2.36b2.02c

CL1008%3.63bc2.19b2.39c

CL6004%7.47ab3.35b3.03bc

CL6008%1.78c2.13b2.41bc

SH1004%7.85ab3.45b2.40c

SH1008%11.38ab6.44a7.75a

SH6004%6.08ab3.06b3.4bc

SH6008%13.23a7.38a5.74ab

Standard error2.800.860.083

P-value0.045
Main effects

Fiber typeCL5.58b2.54b2.43b

SH9.79a4.87a4.55a

Particle size (µm)1007.933.673.23

6007.713.943.8

Level4%7.633.04b2.75b

8%8.024.74a4.45a

Source of variation (P-value)

Fiber type (T)0.020
Particle size (P)0.6220.4740.993

Inclusion level (L)0.9480.0060.001

Type × Level0.003
Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate birds per treatment.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Nutrient Digestibility
The results for nutrient digestibility are shown in Table 9. In the present experiment, all diets were formulated to be isonitrogenous and isocaloric. Statistical differences were observed in the digestibility of dry matter where the group fed 4% SH with fine particle had the highest DM digestibility, whereas the treatment fed 8% SH with coarse particle had the lowest DM digestibility (P = 0.0169). The digestibility of crude protein was improved for the group fed 4% CL with a fine particle and was worst for the groups fed 8% SH (P = 0.0326). No statistical differences were observed in the digestibility of energy (P > 0.05). The results from the main effects indicate that particle size is an important factor in the modulation of nutrient digestibility where the smaller particle (100 μm) increased nutrient digestibility compared to the larger one (600 μm) (P
Table 9
Effects of dietary fiber parameters on the nutrient digestibility of male broilers reared to 21 d of age1.

Fiber type2Particle size (µm)LevelDry matter, %Crude protein, %Energy, kcal/kg

Control--63.83ab82.30abcd3057

CL1004%69.85ab86.59a3006

CL1008%67.44ab84.38abc2842

CL6004%68.20ab83.61abcd2811

CL6008%61.23ab80.75bcd2641

SH1004%71.24a85.11ab2938

SH1008%64.19ab84.42abc2797

SH6004%62.89ab79.38d2720

SH6008%59.02b79.58cd2589

Standard error2.721.80170

P-value0.01690.03260.0730

Main effects

Fiber typeCL66.6883.832825

SH64.3382.122761

Particle size (µm)10068.18a85.12a2896a

60062.84b80.83b2690b

Level4%68.04a83.672869

8%62.97b82.282717

Source of variation (P-value)

Fiber type (T)0.20080.15770.4001

Particle size (P)0.00520.00080.0097

Inclusion level (L)0.00770.24840.0515

Type × Particle size0.43730.41050.9230

Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate cages per treatment, each cage with 12 birds.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Gene Expression
The results for gene expression of nutrient transporters are shown in Table 10. No significant differences were observed in the expression of SGLT-1. However, the expression of Pept-1 was higher for the group fed 8% CL with coarse particle compared to the control group (P = 0.008). The results from the main effects show that none of the individual main effects have a significant impact in the expression of nutrient transporters (P > 0.05). However, the interaction, fiber type × particle size, shows that coarse particle of CL increased the expression of Pept-1 compared to coarse particle of SH (P = 0.0154).

Table 10
Effects of dietary fiber parameters on the jejunal gene expression of male broilers reared to 21 d of age1.

Gene

Fiber type2Particle size (µm)LevelSGLT-1Pept-1

Control--1.001.00b

CL1004%0.4473.17ab

CL1008%0.2451.56ab

CL6004%0.2942.63ab

CL6008%1.2444.11a

SH1004%0.4423.27ab

SH1008%0.0752.39ab

SH6004%0.2371.19ab

SH6008%0.0851.6ab

Standard error0.3440.700

P-value0.080
Main effects

Fiber typeCL0.5582.87

SH0.2102.11

Particle size (µm)1000.3022.38

6000.4652.60

Level4%0.3552.56

8%0.4122.41

Source of variation (P-value)

Fiber type (T)0.1220.124

Particle size (P)0.4630.656

Inclusion level (L)0.7950.752

Type × Particle size0.2440.015

Open in a separate window

Boldface indicates the particle size and inclusion levels of dietary fiber.

1Values are the least-square means of 6 replicate birds per treatment.

2Abbreviations: CL, cellulose, SH, soyhulls.

a-dMeans within a column not sharing a common superscript differ significantly (P
Go to:

DISCUSSION
Growth Performance
To evaluate the impact of fiber type, inclusion level, and particle size, all diets were formulated to be isonitrogenous and isocaloric. However, despite the fact that diets with similar nutrient content were used, there were differences in growth performance among the dietary treatments. Treatments having low fiber inclusion (4% CF) did not differ from the control group. This is in accordance with other researchers that have reported that small inclusions of dietary fiber do not affect negatively the growth performance of broilers (Amerah et al., 2009; Sacranie et al., 2012). However, the treatments fed 8% CF using CL with regardless of particle size had the worst weight gain among dietary treatments whereas those fed 8% CF as SH with a course particle size did not differ from those fed 4% CF. This can be attributed to the differences in fiber types between CL and SH. CL contains a tertiary structure linked together by an extensive number of hydrogen bonds, providing stability, low aqueous solubility and mostly resistance to acid hydrolysis (Festucci-Buselli et al., 2007) which might encapsulate nutrients in the upper digestive tract and reduce the break down at the level of the gizzard leading to interference in the breakdown of other nutrients. The control group had the highest feed intake compared to the other fiber-containing treatments during the entire rearing period in the current study. Other studies also reported that broilers given choice feeding between control and diet containing rice hulls had a lower feed intake compared to the control group (González-Alvarado et al., 2008; Sadeghi et al., 2015). However, other researchers have pointed out the ability of broilers to increase feed intake as a means to compensate for the nutrient dilution when using dietary fiber (Amerah et al., 2009; Sacranie et al., 2012). This is associated to the differences in nutrient content in experimental diets (no isocaloric diets). In our experiment, all diets were isocaloric and isonitrogenous; thus, increases in feed intake should not be expected. The reduction in feed intake of the treatments containing 8% CL in either particle size and 8% SH with a particle size of 100 µm was not expected and can be attributed to the impact of dietary fiber on intestinal motility and passage rate. In contrast to these results, Amerah et al. (2009) reported an increased in feed intake when the control diet was diluted with CL in the ratio 6:10. In our experiment, however, filler (sand) was replaced with the adequate level of CL to maintain the same nutrient content. Differences in FCR were observed just in the first week of the rearing period where the groups fed 4% CF with a particle size of 100 µm had the lowest FCR regardless of the fiber source. The opposite was true for the groups fed 8% CF which had the poorest FCR. However, such differences were not seen in the rest of the experiment. Birds fed CL at 8% had the lowest weight gain irrespective of the particle size. In the case of SH, the group fed 8% CF as SH with a coarse particle did not differ from the groups fed 4% CF. The results from the main effects excluding the control group show that fine particle size of fiber improved weigh gain on d 7 and 14 and FCR on d 7. However, such differences disappeared at the end of the experiment. Similar to these results, Donadelli et al. (2019) found that fine particles reduced the FCR when using different fiber types. Other researchers have suggested that insoluble fiber with coarse particle, in some cases, can help in the improvement of growth performance by modulating intestinal functionality (Choct, 2015). In our experiment, it is important to mention that for CL the groups fed the same amounts of fiber (i.e., 4% or 8%) had similar weight gain in both particle sizes. However, for SH it was observed better results when SH is provided in a coarse particle size compared to the fine particle size. These differences might be associated to the fiber matrix found of soyhulls which is composed of pectins, CL, and hemicellulose (Stein and Parsons, 2008) which interact differently in the gastrointestinal tract compared to purified CL. Groups fed 8% CF had lower weight gain, feed intake, and higher (poorer) FCR compared to those fed 4% SH. In fact, the mortality for groups fed 8% SH was higher. The presence of soluble fiber in SH are the main reason behind increases in mortality, just when given in high amounts as observed in this experiment. Other results have previously been reported that high levels of dietary fiber reduce growth performance parameters in diets with the same nutrient level (Sklan et al., 2003) as well as diets where fiber has been replaced without nutrient adjustment (Hetland and Svihus, 2001), which indicates the ability of high fiber levels to encapsulate the nutrients making them unavailable for absorption (Hetland et al., 2004).

The interaction, type × particle size, was significant on day 7, where coarse SH improved weight gain compared to fine soyhulls. Furthermore, coarse CL decreased weight gain compared to fine CL. These results point out the importance of particle size based on the type of fiber used in the diets. Particle size × level interaction on d 7 for feed intake shows that fine particles at low levels had higher feed intake compared to coarse particles at high levels in the present study. Different researchers have indicated the potential of coarse fibers to modulate digesta passage rate and nutrient digestion by increasing the retention time in the upper digestive tract (i.e., gizzard) (Hetland et al., 2004; Gonzalez-Alvarado et al., 2007). This might explain the higher intake for diets containing fine particle size which fail in stimulating retention of feed components at the level of the gizzard. In the present study, three-way interaction among the main effects on d 14 and 21 for feed intake shows that fine SH at the lower level had the heaviest weight gain, whereas the lowest weight gain was for the group fed coarse and high levels of CL. In chicks, it has been clearly demonstrated that nutrient digestibility increases from 58% to up to 90% when coarse particles are ground to finer particles (Mitchell et al., 1972). It is important to highlight that this is true for nutrient-containing feedstuffs. In the present experiment, SH and CL were used as sources of fiber. SH is a substantial source of fiber (75% NDF) but also contains 16% crude protein and 658 kcal/kg ME (Table 1); on the other hand, CL is a purified source of CL (99% CL) which explains the reason behind the differences in performance when using fine particle size of soyhulls at low levels (4% CF). Three-way interactions also show that the group fed coarse and high levels of CL had the highest feed intake among the dietary treatments despite the fact that all diets were isocaloric and isonitrogenous; however, this was not true for the group fed SH, indicating that high levels of pure insoluble fibers can modulate feed intake in broilers as reported for other researchers (Hetland et al., 2003; Donadelli et al., 2019).

Digestive Organ Growth and Digesta Viscosity
All groups containing CL had a similar relative weight of the gizzard irrespective of the inclusion level or particle size. This has been seen by other researchers when using small amounts (
In the present study, the interactions among the main effects were observed; the increase of fine SH in the diet caused significantly higher digesta viscosity compared to coarse SH, and fine and coarse CL. This is because the interaction of fiber with water is determined not only by fiber type (i.e., soluble or insoluble) but for its physical properties as well, where smaller particle size can increase water absorption due to higher surface area available to interact with water molecules (Strange and Onwulata, 2002). Interestingly, no significant differences were observed in the relative weights of the ceca. Similar to these results, Gonzalez-Alvarado et al. (2007) did not observed significant differences in the ceca weights of broilers fed 3% SH compared to the control group; however, birds fed insoluble fiber (oat hulls) did have a lower ceca weight compared to the control group. This contrast could be attributed to the fact that these authors used oat hulls as source of insoluble fiber which contains other non-cellulosic components including lignin, protein, and fat (Welch et al., 1983), resulting in different results. From the main effects it is clear that fiber with coarse particle (i.e., 600 µm) increased the relative weights of the gizzard on d 21 compared to fine particle (i.e., 100 µm). This was more pronounced in the diets containing SH as the source of fiber. This can be attributed to the fact that natural fibers have a higher level of polymerization (Hivechi and Bahrami, 2016) resulting in higher stimulation of the muscles of the gizzard. The fiber level was certainly of influence in the stimulation of the gizzard and also the relative weight of the small intestine. This indicates the need to compensate for the increase of the digesta volume caused by the bulkiness of the fiber particles as observed for other researchers using different fiber types (Hetland et al., 2004; Svihus, 2011; Rezaei et al., 2018).

Intestinal Histomorphology
The treatment 4% SH with coarse particle increased duodenal villus height compared to the group fed 8% CL with fine particle in the current study. This might be associated with the stimulation of the reverse peristalsis provoked by the presence of coarse fiber particles which results in increased villus development (Sacranie et al., 2012). It was also observed that the presence of fine particles in the form of CL reduced the duodenal villus to crypt ratio, indicating a reduction in duodenal functionality. High levels of SH with fine particle size reduced the jejunal villi. However, low levels of SH with fine particle improved jejunal villus to crypt ratio when compared to high levels with fine particle. This inclusion level-dependent differences could be attributed to the excessive abrasive effect of fiber caused when high levels of soyhulls are added to the diet, causing a reduction in villus height as observed by other authors when using other fiber types (Montagne et al., 2003; Sadeghi et al., 2015). This is supported by Tejeda and Kim (2020) who reported that soyhulls fed at 4% crude fiber resulted in improvements in intestinal morphology, but the opposite was true when fed at 6 and 8% CF. Furthermore, the soluble carbohydrates present in SH can also be a reason behind the reduction in jejunal villus height. It has been suggested that soluble carbohydrates can increase the rate of epithelial cell losses, negatively affecting villus growth (Montagne et al., 2003). In the present experiment, it was observed that the highest intestinal viscosity was for groups fed high levels of SH with fine particle and it can, therefore, be concluded that viscosity played an important role in the atrophy of jejunal villi. The ileal villus was highest for the control group compared to the rest of the treatments. However, the ileal villus to crypt ratio was higher for the 8% CL with coarse particle and smallest for all treatments containing SH. The presence of coarse particles of soluble fiber seems to reduce the development of the ileal villus to crypt ratio. This could be associated to the stimulation of pathogenic bacteria of the undigested carbohydrates at the end of the digestive tract. In accordance with the results in the present experiment, Sadeghi et al. (2015) reported that soluble carbohydrates from sugar beep pulp decreased the ileal villus in broiler compared to the control group. The impairment in the development of ileal villus could, therefore, be associated to the increase in bacterial activity that interferes with the normal intestinal development (Pan and Yu, 2014).

Nutrient Digestibility and Gene Expression
Dietary fibers have been reported to modulate nutrient digestibility in broilers and other poultry species (Cao et al., 2003; Hetland et al., 2003; Amerah et al., 2009; Sacranie et al., 2012). In the present study, the dry matter digestibility was higher for the 4% SH group compared to the 8% SH treatment. From these results, it is clear that the digestibility of dry matter is negatively affected by the presence of soluble fibers (i.e., pectins) present in the SH. Similarly, Silva et al. (2013) reported a quadratic decrease in dry matter digestibility with increases of pectin in the diets of broilers. Interestingly, in the present experiment we observed that small amounts of SH increase the dry matter digestibility which could be associated to a slight increase in the retention time that allows for more breakdown of the dry matter. However, the digestibility of crude protein was higher for the 4% CL group with fine particle compared to the 4% SH group with coarse particle. The fact that coarse particles had lower digestibility of crude protein can be associated to the increase in endogenous amino acid losses caused by higher epithelial cell turnover driven by particle size instead of fiber level (Montagne et al., 2003). In this case, diets with fine CL particles would have lowered endogenous amino acid flow and, therefore, higher protein digestibility. It has been suggested that large particles could slow down the passage rate of digesta at the level of the upper gastrointestinal tract (i.e., gizzard), which would create a prolonged the exposure of nutrients to digestive enzymes, increasing nutrient digestibility (Amerah et al., 2007); however, the effects at the level of the small intestine seem to affect nutrient metabolism differently. Numerical differences in energy digestibility indicate that higher inclusions of fiber reduce energy digestibility despite the fact that diets were formulated to be isocaloric. This might be due to interactions of dietary fiber with other more digestible carbohydrates and/or fat in the diet that renders such nutrients unavailable (Hetland et al., 2004), especially when dietary fiber is given in high amounts. The main effects indicate that coarse particles decreased the digestibility of energy compared to fine particles. Despite the fact that coarse particles can stimulate the upper digestive tract, improving gizzard relative weight, as observed in the present study, the reduction in energy digestibility associated with coarse particles could be attributed to the smaller surface area of coarse particles when compared to smaller particles, which results in a reduction in the accessibility to digestive enzymes (Carré et al., 2005; Amerah et al., 2007).

No significant differences were observed in the expression of jejunal sodium-dependent glucose transporter 1. However, the expression of Pept-1 was higher for the group fed 8% CL with coarse particle compared to the control group. Interestingly, this group had the poorest performance and no improvement in crude protein digestibility among the dietary treatments, which indicates the upregulation of nutrient transporters as a means to compensate the reduction on performance. Kheravii et al. (2018a) reported the reduction in weight gain and the upregulation of intestinal cationic aminoacid transporter 1, and peptide transporter-2 in broilers fed 2% sugar bagasse with a coarse particle size. In accordance with these authors, the interaction, fiber type × particle size, showed that coarse particle of CL increased the expression of Pept-1 compared to coarse particle of SH in the current study. However, the upregulation of Pept-1 did not result in an improved crude protein digestibility. On the contrary, low levels of insoluble fiber in a fine particle size improved crude protein digestibility, indicating that these improvements in digestibility might be associated to the endogenous amino acid losses; the reduction in the endogenous amino acid losses by fine CL inclusion might result in a lower need of amino acid uptake by the transporters. On the other hand, the higher abrasive effect of coarse particles increases the need for amino acid uptake, upregulating the expression of Pept-1. Furthermore, birds from the fine CL group had the lowest feed intake which can be attributed to the slower digesta passage rate due to the bulkiness of the diets containing CL. Similar to these results, Khempaka et al. (2009) reported a reduction in feed intake with increases in died cassava pulp containing 27% insoluble fiber. Therefore, the reduction in feed intake leads to a lower nutrient intake and a higher need to compensate for the lack of nutrients stimulating the upregulation of nutrient transporters such as Pept-1.

Go to:

CONCLUSIONS
Dietary fiber type, inclusion level, and particle size are important factors determining the functionality of the fibrous feed components. In the present study, it was observed that 4% SH diets with fine particles had similar weigh gain compared to the control group and improved the feed efficiency during the first week of the experiment. An improvement in jejunal villus to crypt ratio was also observed in such diets, indicating a positive modulation of the gastrointestinal tract. High levels of SH increased relative weights of the gizzard and small intestine but reduced performance and increase mortality due to increases in intestinal viscosity. This indicates that SH can be added to diets to achieve 4% CF (i.e., 5–6% in a corn-soybean meal diet) without causing any deleterious effect and with a high potential to improve intestinal functionality. Expression of Pept-1was not related to digestibility of crude protein due to potential endogenous loses caused by abrasion of dietary fiber. In summary, type of fiber, inclusion level, and particle size should be considered when using fibrous feedstuffs since these are determining factors affecting growth performance, intestinal morphology, nutrient digestibility, nutrient metabolism, and further research is granted to understand the role of fibrous feed ingredient in the nutrient matrix. This will provide us a way to be able to incorporate cheaper feed ingredients.

Go to:

DISCLOSURES
There is no conflict of interest.

Go to:

REFERENCES

Amerah A.M., Ravindran V., Lentle R.G. Influence of insoluble fibre and whole wheat inclusion on the performance, digestive tract development and ileal microbiota profile of broiler chickens. Br. Poult. Sci. 2009;50:366–375. [PubMed] [Google Scholar]

Amerah A.M., Ravindran V., Lentle R.G., Thomas D.G. Feed particle size: implications on the digestion and performance of poultry. W. Poult. Sci. J. 2007;63:439–455. [Google Scholar]

Cao B.H., Zhang X.P., Guo Y.M., Karasawa Y., Kumao T. Effects of dietary cellulose levels on growth, nitrogen utilization, retention time of diets in digestive tract and caecal microflora of chickens. Asian-Australasian J. Anim Sci. 2003;16:863–866. [Google Scholar]

Carré B., Muley N., Gomez J., Oury F.X., Laffitte E., Guillou D., Signoret C. Soft wheat instead of hard wheat in pelleted diets results in high starch digestibility in broiler chickens. Br. Poult. Sci. 2005;46:66–74. [PubMed] [Google Scholar]

Chaplin M.F. Fibre and water binding. Proc. Nutr. Soc. 2003;62:223–227. [PubMed] [Google Scholar]

Chiou P.W.S., Lu T.W., Hsu J.C., Yu B. Effect of different sources of fiber on the intestinal morphology of domestic geese. Asian-Australasian J. Anim. Sci. 1996;9:539–550. [Google Scholar]

Choct M. Fibre - chemistry and functions in poultry nutrition. LII Simp. Cient. Avicultura. 2015:113–119. [Google Scholar]

Cobb-Vantress. 2018. Broiler performance and nutrition supplement Cobb500. Accessed Jan. 2021. http://www.cobb-vantress.com/docs/default-source/cobb-500-guides/cobb500-broiler-performance-nutrition-supplement-(english).pdf

Dansky L.M., Hill F.W. Application of the chromic oxide indicator method to balance studies with growing chickens: two figures. J. Nutr. 1952;47:449–459. [PubMed] [Google Scholar]

Donadelli R.A., Stone D.A., Aldrich C.G., Beyer R.S. Effect of fiber source and particle size on chick performance and nutrient utilization. Poult. Sci. 2019;98:5820–5830. [PubMed] [Google Scholar]

Festucci-Buselli R.A., Otoni W.C., Joshi C.P. Structure, organization, and functions of cellulose synthase complexes in higher plants. Braz. J. Plant Physiol. 2007;19:1–13. [Google Scholar]

Georgieva V., Chobanova S., Todorov N., Pavlov D. Effect of dietary crude fiber on endogenous dry matter and nitrogen excretion in cockerels. Bul. J. Agric. Sci. 2014;20:903–908. [Google Scholar]

Gonzalez-Alvarado J.M., Jimenez-Moreno E., Lazaro R., Mateos G. Effect of type of cereal, heat processing of the cereal, and inclusion of fiber in the diet on productive performance and digestive traits of broilers. Poult. Sci. 2007;86:1705–1715. [PubMed] [Google Scholar]

González-Alvarado J.M., Jiménez-Moreno E., Valencia D.G., Lázaro R., Mateos G. Effects of fiber source and heat processing of the cereal on the development and pH of the gastrointestinal tract of broilers fed diets based on corn or rice. Poult. Sci. 2008;87:1779–1795. [PubMed] [Google Scholar]

Hetland H., Choct M., Svihus B. Role of insoluble non-starch polysaccharides in poultry nutrition. W. Poult. Sci. J. 2004;60:415–422. [Google Scholar]

Hetland H., Svihus B. Effect of oat hulls on performance, gut capacity and feed passage time in broiler chickens. Br. Poult. Sci. 2001;42:633–637. [PubMed] [Google Scholar]

Hetland H., Svihus B., Krogdahl A. Effects of oat hulls and wood shavings on digestion in broilers and layers fed diets based on whole or ground wheat. Br. Poult. Sci. 2003;44:275–282. [PubMed] [Google Scholar]

Hivechi A., Bahrami S.H. A new cellulose purification approach for higher degree of polymerization: modeling, optimization and characterization. Carb. Pol. 2016;152:280–286. [PubMed] [Google Scholar]

Jaworski N.W., Lærke H.N., Knudsen K.E., Stein H.H. Carbohydrate composition and in vitro digestibility of dry matter and nonstarch polysaccharides in corn, sorghum, and wheat and coproducts from these grains. J. Anim. Sci. 2015;93:1103–1113. [PubMed] [Google Scholar]

Jiménez-Moreno E., De Coca-Sinova A., González-Alvarado J.M., Mateos G. Inclusion of insoluble fiber sources in mash or pellet diets for young broilers. 1. Effects on growth performance and water intake. Poult. Sci. 2016;95:41–52. [PubMed] [Google Scholar]

Khempaka S., Molee W., Guillaume M. Dried cassava pulp as an alternative feedstuff for broilers: effect on growth performance, carcass traits, digestive organs, and nutrient digestibility. J. Appl. Poult. Res. 2009;18:487–493. [Google Scholar]

Kheravii S.K., Morgan N.K., Swick R.A., Choct M., Wu S.B. Roles of dietary fibre and ingredient particle size in broiler nutrition. W. Poult. Sci. J. 2018;74:301–316. [Google Scholar]

Knudsen K.E.B. Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets. Poult. Sci. 2014;93:2380–2393. [PubMed] [Google Scholar]

Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods. 2001;25:402–408. [PubMed] [Google Scholar]

Mitchell R.J., Waldroup P.W., Hillard C.M., Hazen K.R. Effects of pelleting and particle size on utilization of roasted soybeans by broilers. Poult. Sci. 1972;51:506–510. [Google Scholar]

Montagne L., Pluske J.R., Hampson D.J. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive health in young non-ruminant animals. Anim. F. Sci. Technol. 2003;108:95–117. [Google Scholar]

Nguyen N., Jacobs M., Li J., Huang C., Li D., Navarro D.L., Stein H.H., Jaworski N.W. Technical note: concentrations of soluble, insoluble, and total dietary fiber in feed ingredients determined using method AOAC 991.43 are not different from values determined using method AOAC 2011.43 with the AnkomTDF dietary fiber analyzer. J. Anim. Sci. 2019;97:3972–3983. [PMC free article] [PubMed] [Google Scholar]

O'Dell B.L., Newberne P.M., Savage J.E. An Abnormality of the proventriculus caused by feed texture. Poult. Sci. 1959;38:296–301. [Google Scholar]

Owusu-Asiedu A., Patience J.F., Laarveld B., Van Kessel A.G., Simmins P.H., Zijlstra R.T. Effects of guar gum and cellulose on digesta passage rate, ileal microbial populations, energy and protein digestibility, and performance of grower pigs. J. Anim. Sci. 2006;84:843–852. [PubMed] [Google Scholar]

Pan D., Yu Z. Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes. 2014;5:108–119. [PMC free article] [PubMed] [Google Scholar]

Rezaei M., Karimi Torshizi M.A., Wall H., Ivarsson E. Body growth, intestinal morphology and microflora of quail on diets supplemented with micronised wheat fibre. Br. Poult. Sci. 2018;59:422–429. [PubMed] [Google Scholar]

Sacranie A., Svihus B., Denstadli V., Moen B., Iji P.A., Choct M. The effect of insoluble fiber and intermittent feeding on gizzard development, gut motility, and performance of broiler chickens. Poult. Sci. 2012;91:693–700. [PubMed] [Google Scholar]

Sadeghi A., Toghyani M., Gheisari A. Effect of various fiber types and choice feeding of fiber on performance, gut development, humoral immunity, and fiber preference in broiler chicks. Poult. Sci. 2015;94:2734–2743. [PubMed] [Google Scholar]

Saki A.A., Matin H.R.H., Zamani P., M.Tabatabai M., Vatanchian M. Various ratios of pectin to cellulose affect intestinal morphology, DNA quantitation, and performance of broiler chickens. Liv. Sci. 2011;139:237–244. [Google Scholar]

Silva V.K., de Souza Morita V., Boleli I.C. Effect of pectin extracted from citrus pulp on digesta characteristics and nutrient digestibility in broilers chickens. Rev. Bras. Zootec. 2013;42:575–583. [Google Scholar]

Sittiya J., Yamauchi K., Nimanong W., Thongwittaya N. Influence of levels of dietary fiber sources on the performance, carcass traits, gastrointestinal tract development, fecal ammonia nitrogen, and intestinal morphology of broilers. Rev. Bras. Cien. Avi. 2020;22:1–8. [Google Scholar]

Sklan D., Smirnov A., Plavnik I. The effect of dietary fibre on the small intestines and apparent digestion in the turkey. Br. Poult. Sci. 2003;44:735–740. [PubMed] [Google Scholar]

Stein H.H., Parsons C.M. In: Pages 613-660 in Soybeans, Chemistry, Production, Processing, and Utilization. Johnson L.A., White P.J., Galloway R., editors. AOCS Press; Urbana, IL: 2008. Nutritional properties and feeding values of soybeans and their coproducts. [Google Scholar]

Strange E.D., Onwulata C.I. Effect of particle size on the water sorption properties of cereal fibers. J. F. Qual. 2002;25:63–73. [Google Scholar]

Svihus B. The gizzard: function, influence of diet structure and effects on nutrient availability. W. Poult. Sci. J. 2011;67:207–223. [Google Scholar]

Tejeda O.J., Kim W.K. The effects of cellulose and soybean hulls as sources of dietary fiber on the growth performance, organ growth, gut histomorphology, and nutrient digestibility of broiler chickens. Poult. Sci. 2020;99:6828–6836. [PMC free article] [PubMed] [Google Scholar]

Tejeda O.J., Kim W.K. Role of dietary fiber in poultry nutrition. Animal. 2021;11:1–16. [Google Scholar]

Welch R.W., Hayward M.V., Jones D.I.H. The composition of oat husk and its variation due to genetic and other factors. J. Sci. F. Agric. 1983;34:417–426. [Google Scholar]

انجمن تغذیه دام-طیور و آبزیان کرمان...
ما را در سایت انجمن تغذیه دام-طیور و آبزیان کرمان دنبال می کنید

برچسب : نویسنده : ankerman86b بازدید : 52 تاريخ : دوشنبه 27 شهريور 1402 ساعت: 1:45